dmontes011 dmontes011

01-10-2015
English

contestada

A limerick has four lines. True False

Respuesta :

nochillalisa nochillalisa

01-10-2015

False. A limerick has 5 lines.

Answer Link

Otras preguntas

How was the battle of bunker hill an american success even though it was a british victory?

I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

U.s. president woodrow wilson's fourteen points was a proposal based on what post-war principle?

What does Thomas Jefferson mean by Certain unalienable rights and the in the excerpt from the Declaration of Independence

True or False. An object's mass will change if you move it from the Earth to the Moon.

There are only three types of polygons that can be the faces of a Platonic solid. They are _____, _____, and _____. Check all that apply. A. rectangles B. squar

Which of the following do scientists think will probably cause Earth's next ice age?

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

define intrinsic motivation