zoraiz123 zoraiz123
  • 02-02-2017
  • History
contestada

What would result from the growth of a city?

Respuesta :

Аноним Аноним
  • 02-02-2017
Well a number of things but most likely, the resources would go down but probably not by much. I hope this as helped :D
Answer Link
jillkatzenback
jillkatzenback jillkatzenback
  • 02-02-2017
Economically, urbanization causes prices to rise in real estate, causing people to move away from the city because they can't afford to stay in the city. Environmentally, urbanization creates 'heat islands' which areas that have higher temperatures because there is less open land and vegetation. 
Answer Link

Otras preguntas

define concentric circles
where are the three parts of an atom located
Please answer theses division problems!! 9 divided by 3/7
Give a recursive algorithm for finding the sum of the first n odd positive integers.
What was religion like in Shang China?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
how do i find the angles on a kite?
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w