mriver851
mriver851 mriver851
  • 02-06-2022
  • Mathematics
contestada

In the figure below, what is the value of xº?

In the figure below what is the value of xº class=

Respuesta :

ponytom13
ponytom13 ponytom13
  • 02-06-2022

Answer:

62 degree

Step-by-step explanation:

A triangle has 180 degree

180 - (43 + 75) = 62

Answer Link

Otras preguntas

There are only three types of polygons that can be the faces of a Platonic solid. They are _____, _____, and _____. Check all that apply. A. rectangles B. squar
what is 3(2x-4)=5x+2
Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.
A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.
Arrange the steps in the correct order for creating a digital image and saving it.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is true about the energy involved in a chemical reaction? (3 points) The amount of energy is constant, but it is converted from one form to another. T
Solving this question
Insulin is a protein that is used by the body to regulate both carbohydrate and fat metabolism. a bottle contains 425 ml of insulin at a concentration of 20.0 m
what is the most important factor that holds a gene pool of a species together and prevents speciation?