realpcy8989 realpcy8989
  • 02-03-2022
  • Geography
contestada

Which country is home to a major lake that is half fresh water and half salt water?.

Respuesta :

Parrain
Parrain Parrain
  • 28-03-2022

The country that is home to the major lake which is special for being half fresh and half salt water is Kazakhstan.

What lake is in Kazakhstan?

The Lake Balkhash in Kazakhstan is one of the largest lakes in the world and is known to be half salty and half fresh.

The part that is fresh is the western part and the eastern part is salty. Sadly the lake is shrinking due to human activities but it is still a sight to behold.

Find out more on Kazakhstan at https://brainly.com/question/18294008.

Answer Link

Otras preguntas

four yardequal Blank feet
What is the range of function of y-1=(x+3)^2
define concentric circles
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
A vehicle is only 15% efficient. What happened to the other 85%?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
Susan ........ (Run) to school because she was late.
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore