mirlourdjie33 mirlourdjie33

03-11-2021
History

contestada

Why future humanity is important

Respuesta :

chiappejk chiappejk

03-11-2021

Answer:

its important that people exist for there be someone in the earth and some people says its not important cause humans damage the world.

Explanation:

Answer Link

Otras preguntas

Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?

What is the elapsed time

These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Need Help Fast 33 points please Factor x2 + 10x – 18.

What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?

how many moles of NaCl are equivalent to 15.6g NaCl

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

3∙(a+x), if a=8; x=−10