marziehgreene25 marziehgreene25

03-06-2021
Mathematics

contestada

Which sign makes the statement true?
9
No
12
12
<
=

Respuesta :

mikaylachantalmagpoc mikaylachantalmagpoc

03-06-2021

Answer:

12=12

Step-by-step explanation:

#hopeithelps

stay safe and keep well

mark me as brain liest pls

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Jacky spent 53% of all her money to buy a computer game. How much did the game cost, if Jacky had $120 before buying the game?

The sterile material that is placed directly on a wound is termed the:

The number of students in the book club is increasing at a rate of 15% per year. In 2010 there were 9 students in the book club. Find the number of students exp

If two populations are isolated, they may become separate species because they are not longer ________.

stars and planets are made from gases in a

A school bus has 22 rows of seats, and 4 students can be seated in each row. students have filled 19 rows of seats, abd 1/2 of the remaining seats. how many sea

How have terrorism and the 9/11 attacks changed the policies of the United States in regards to immigrants and terrorism? Discuss the events of 9/11 and the War

Explain the carbon cycle and explain why burning fossil fuels is an issue.

What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?