pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

How did English ideas about government and the economy influence life in the 13 colonies
The tense of the verb terrebat is ____________. present imperfect future
According to Erikson, which major challenge is faced by young adults? A)searching for identity B)developing skills C)establishing close bonds with others D)
18. Oxygen, sodium, and boron are examples of what type of matter? (4 points) Solution Compound Element Heterogeneous mixture 19. The compound H2O is an example
What is the product common factor of 4 and 10 and the least common factor of 4 and 10?
Which volcanic islands lie between the kamchatka peninsula and japan?
A trireme is a type of _____. government sculpture ship soldierv
What do scientists fear the effect of continued logging will be on the rain forests??
The following were accomplishments of the state reconstruction-era governments in the south except what?
What layer of the atmosphere is the least dense?