HAHAHAHAHAHAHHAHAHAA HAHAHAHAHAHAHHAHAHAA

01-04-2021
English

contestada

if the points are the third quadrant then the coordinates are both negative inverse

Respuesta :

poppyxx05 poppyxx05

01-04-2021

Answer:

uh yeh

Explanation:

Answer Link

Otras preguntas

i need help with this asap please help me

What atom is the smallest size? A. Li B. Be C. F D. C

which health related components give you a normal or an above average classification?

3. Escribo los tipos de texto que corresponden a cada situación.• En una iglesia:. . En un restaurante:En una estación de bus:• En un museo:. En el cine:Por fav

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Adolph Hitler's use of propaganda against the Jews led to them being persecuted, rounded up, sent to concentration camps and ghettos, and exterminated. By the e

who was william gladstone?

Jacob's Diner offers its clients a choice of regular and diet soda. Last night, the diner served 85 sodas in all, 40% of which were regular. How many regular so

Help me plisssssssssssssss

can someone please help meeee?