0sid0
0sid0 0sid0
  • 02-02-2021
  • Mathematics
contestada

Can 4cm 6cm and 12cm make a triangle

Respuesta :

armag armag
  • 02-02-2021
No, the sum of the lengths of any two sides must be greater than the length of the third side
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help solve, thanks in advance!
I want to work with LDAP. what is LDAP?
How much money, in dollars, does one mole of nickels represent?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want