jodiewood12 jodiewood12
  • 04-05-2020
  • Mathematics
contestada

solve proporation h/9=2/3

Respuesta :

clarissa0011
clarissa0011 clarissa0011
  • 04-05-2020
h = 6. if you were to plug in 6 and simplify, if would be 2/3.
Answer Link

Otras preguntas

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Explain who or what "Año Viejo" is and its significance.
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
A generator stores electric current. Explain why you agree or disagree with this statement
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures