phirejz5692 phirejz5692
  • 02-01-2020
  • Computers and Technology
contestada

A(n) __________ network is a high speed communications connection used to exchange data between production line equipment and other devices within a manufacturing facility.

Respuesta :

Debel
Debel Debel
  • 03-01-2020

Answer:

Industrial network

Explanation:

Networks is simply a medium to transfer data and one example is an industrial network which is a high speed communications connection network that deal with the exchange of data on a large scale between the production line equipment and other devices within a manufacturing facility.

Answer Link

Otras preguntas

punctuated equilibrium definition biology
Many assume that presidents with high __________ are more effective leaders.
Identify the specific sensory receptors for each of the five common senses.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
At the height of the vietnam war, the united states stationed approximately how many troops in vietnam?
CAN SOMEONE HELP ME WITH THIS PLEASE ??
Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.
You have four coins 1 ¢ 5 ¢ 10 ¢ 25 ¢ How many different sums of money can you select? Use set notation to list all the options you have. How many options wi
. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm
Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a