sara200148
sara200148 sara200148
  • 02-09-2018
  • Mathematics
contestada

Can someone help me with my work

Can someone help me with my work class=

Respuesta :

Аноним Аноним
  • 03-09-2018

For all of these problems, make equation into slope-intercept form to be able to see what the slope is.

answer to 1.d. is neither

Ver imagen Аноним
Answer Link

Otras preguntas

what are the zeros of the function? f(x)=+-6x
can someone help me please
Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.
The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.
Plane ABC and plane BCE ____ be the same plane. Question 4 options: cannot must may
SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1
Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s
Compared to citizens of other nations, americans are _______ involved in politics and community affairs and vote at ________ levels.